Fam114a1 gene
WebNCBI's Gene Expression Omnibus (GEO) is a public archive and resource for gene expression data. WebDec 28, 2024 · In mammals, miR-574 is located in intron 1 of the host gene FAM114A1 (Family with sequence similarity 114 member A1; Fig 1B). We confirmed that both miR-574-5p and miR-574-3p were significantly …
Fam114a1 gene
Did you know?
Webfam114a1. sections. tissue brain single cell type tissue cell type pathology disease immune cell blood protein subcellular cell line structure metabolic about. introduction history organization publications antibody submission antibody availability acknowledgments contact news. news articles press room ... WebFAM114A1. gene product. Noxp20. The protein encoded by this gene belongs to the FAM114 family and may play a role in neuronal cell development. Alternative splicing …
WebGene symbol: FAM114A1: Gene ID (NCBI) 92689: Conjugate: Unconjugated: Form: Liquid: Purification Method: Antigen affinity purification: Storage Buffer: PBS with 0.02% sodium azide and 50% glycerol pH 7.3. Storage Conditions: Store at … WebMutation details: This allele from project Fam114a1-7878J-M7854 was generated at The Jackson Laboratory by injecting Cas9 RNA and 4 guide sequences ACCAAGCAACCACATCTCCC, AGATGTGGTTGCTTGGTGGT, TTTGACATAGCGTACATTGA and ATGGAGTTTAACGTTTGCTC, which resulted in a …
WebUse Bio-Rad's PrimePCR assays, controls, templates for your target gene. Every primer pair is optimized, experimentally validated, and performance guaranteed. FAM114A1 - … WebOfficial gene symbol, which is typically a short form of the gene name, according to HGNC. FAM114A1 (Noxp20) Protein classi. Assigned HPA protein class (es) for the encoded protein (s). Read more. Number of transcriptsi. Number of protein-coding transcripts from the gene as defined by Ensembl. 3.
WebContact UAB Privacy Terms of Use © 2024 The University of Alabama at Birmingham; UAB is an Equal Opportunity/Affirmative Action Employer committed to fostering ...
Webby Gene › by Protein › FAM114A1 Antibodies; FAM114A1 Antibodies . Antibodies that detect FAM114A1 can be used in several scientific applications, including Western Blot, Immunohistochemistry, Immunocytochemistry and Immunoprecipitation. These antibodies target FAM114A1 in Human, Mouse and Rat samples. Our FAM114A1 polyclonal … physics book 2nd yearWebJul 8, 2024 · FAM114A1 is a critical autonomous factor for CF proliferation, activation, and migration. Mechanistically, FAM114A1 interacts with angiotensin receptor-associated … physics book class 10 sindh boardFAM114A1 is located on the short arm of Chromosome 4 (4.p14) in humans on the forward strand sense, it starts at base pair 38869354 and ends at 38947365. Its mRNA has 4138 bp. The gene has the following neighbors on the same chromosome: TLR1: Toll-like receptor (TLR) 1 plays a role in pathogen recognition and activation of innate immunity. TLR6: Toll-like receptor (TLR) 6 plays a role in pathogen recognition and activation o… toolings and fixturesWebSep 1, 2024 · Fam114a2, also known as C5orf3 and its paralog Fam114a1, belong to nervous overexpress protein family and have been implicated in neuronal cell … physics book class 11 ncert pdfhttp://www.biodragon.cn/cgkt/96393.html physics book 4 topicsWebfam114a1 ID ZDB-GENE-070410-52 Name family with sequence similarity 114 member A1 Symbol fam114a1 Nomenclature History Previous Names. zgc:162266; Type protein_coding_gene Location Chr: 1 Mapping Details/Browsers Description Orthologous to human FAM114A1 (family with sequence similarity 114 member A1). ... physics book class 11 kpk boardWebPlease note that both primary and metastatic patient data is used in the survival analysis physics book class 12 kpk board